www.iita.org I www.cgiar.org
Next Generation Sequencing (NGS) Approach to Investigate
Role of Small RNAs in Cassava Defense Mechanism to
Cassava Mosaic Disease (CMD)
Olagunju T.1,2 and Gisel A.1
1International Institute of Tropical Agriculture, IITA, Ibadan, Nigeria.
2University of Ibadan, Ibadan, Nigeria.
21st IARSAF Symposium, IITA Ibadan, April 2018
www.iita.org I www.cgiar.org
INTRODUCTION
• Cassava crop important for food security
• SSA produces around 9.2 tons/ha | world average 12.3
tons/ha
• A number of factors responsible for this including pests
and diseases such as CBSD and CMD (Hillocks et al.,
2015; Mohammed et al., 2016).
• Tackling this menace entails deep understanding of host-
virus interaction for enhanced breeding.
www.iita.org I www.cgiar.org
INTRODUCTION CONTD.
• When infected by virus, plants put up a defense!
• One of such defense mechanisms involves production of
small RNAs
• Small RNAs act to post-transcriptionally regulate target
genes
Figure 1: Mechanism of gene silencing by small RNAs
www.iita.org I www.cgiar.org
INTRODUCTION CONTD.
• NGS technologies with high parallelization of sample
sequencing have made it easier to understand genomic
bases of diseases
Sequencing
PCR
Library
preparation
Figure 2: Steps in NGS sequencing
Source: https://www.slideshare.net/ueb52/introduction-to-next-generation-sequencing-v2
www.iita.org I www.cgiar.org
OBJECTIVES
• In this work, we aim to study the defense mechanism of Cassava
when infected with CMV using a computational technique based on
NGS high throughput sequencing data
1. Identify the small RNAs that are produced upon CMV infection
2. Predict the gene targets of these small RNAs
3. Compare the expression profiles of the susceptible clones with
respect to the resistant clones to CMD
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
TMEB117 TMS4(2)425
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
TMEB117 TMS4(2)425 TMS961089A TMS011412
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS
• Four genotypes of two resistant and two susceptible
Cassava plants to CMD in three replicates
• RNA extracted from leaf samples for sequencing
TMEB117 TMS4(2)425 TMS961089A TMS011412
Figure 3: Cassava genotypes used for the study
www.iita.org I www.cgiar.org
MATERIALS AND METHODS CONTD.
Computational pipeline for the analysis
Sequence Quality control
Expression
Analysis
Experimental
verification
Regulatory
network analysis
Target Prediction
Figure 4: Pipeline for the computational analysis
P-value <= 0.05
www.iita.org I www.cgiar.org
RESULTS
Host and virus mapping
0
50000
100000
150000
200000
250000
300000
350000
Total reads
Genome-aligned reads
Virus-aligned reads
Figure 5: Mapping profile of the Cassava genotypes to the host genome and virus repository
www.iita.org I www.cgiar.org
RESULTS contd.
Table1: List of some small RNAs and the targets
Exp ID source Chromosome Sequence sample1 sample2 sample3 target chromosome MFE p-value
target
feature target gene
AB A1-13163_21_x103 Chromosome01 TACACCACCGGACCAATAGAA 103 10 158 Scaffold01258-32208-33206 -35.9 0.049197 gene Manes.S079000
AB A1-749563_21_x463 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
AB A1-2429018_20_x910 Chromosome08 AGGCGTTGGTGAAAAGGTAA 910 18 2780 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700
AD A1-507298_21_x1040 Chromosome15 TTCTCAACTTCAGGATCTGGA 4957 1464 11841 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300
AD A2-1428860_21_x21 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
AD A3-975428_21_x13 Chromosome02 TTGGGCTTGATCCTGTTGCTC 22 30 13 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100
CB C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
CB C2-212596_20_x66 Chromosome08 AGGCGTTGGTGAAAAGGTAA 124 66 74 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700
CB C4-1449608_21_x13 Chromosome01 CGAACAAGTTGAGCGGAGTGG 33 23 13 Chromosome10-16304233-16305231 -37.9 0.027946 no annotation
CD C1-101279_21_x5253 Chromosome15 TTCTCAACTTCAGGATCTGGA 5253 2488 2660 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300
CD C1-1071842_21_x3 Chromosome02 TTGGGCTTGATCCTGTTGCTC 315 93 260 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100
CD C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMEB117 with both resistant lines
Genotype TMS961089A TMS011412
Common 163
Peculiar 55 15
Total 218 178
1516355
TMS961089A TMS011412
Figure 6: Comparison of TMEB117 with the two resistant genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMS4(2)425 with both resistant lines
Genotype TMS961089A TMS011412
Common 158
Peculiar 57 19
Total 215 177
1915857
TMS961089A TMS011412
Figure 7: Comparison of TMS4(2)425 with the two resistant genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
• Comparing TMEB117 with TMS4(2)425
Genotype TMEB117 TMS4(2)425
Common 212
Peculiar 18 22
Total 230 234
2221218
TMEB117 TMS4(2)425
Figure 8: Comparison of the two susceptible genotypes to CMD
www.iita.org I www.cgiar.org
RESULTS contd.
Preliminary findings
• Small RNAs produced upon CMV infection have been identified in the genotypes
of Cassava that are susceptible to CMD
• The targets of the identified small RNAs have been predicted
• Non-mapping of the identified small RNAs to miRBase is an interesting
development – this suggests novelty
www.iita.org I www.cgiar.org
RESULTS contd.
Preliminary findings
• Small RNAs produced upon CMV infection have been identified in the genotypes
of Cassava that are susceptible to CMD
• The targets of the identified small RNAs have been predicted
• Non-mapping of the identified small RNAs to miRBase is an interesting
development – this suggests novelty
Future directions
• Analysis of the gene regulatory network mediated by these miRNAs
• Laboratory verification of these targets using RT-PCR
www.iita.org I www.cgiar.org
• Thank you for listening
www.iita.org I www.cgiar.org
Acknowledgements
Andreas Gisel (PhD)
Angela Makolo (PhD)

Next Generation Sequencing (NGS) Approach to Investigate ​ Role of Small RNAs in Cassava Defense Mechanism to ​ Cassava Mosaic Disease (CMD)

  • 1.
    www.iita.org I www.cgiar.org NextGeneration Sequencing (NGS) Approach to Investigate Role of Small RNAs in Cassava Defense Mechanism to Cassava Mosaic Disease (CMD) Olagunju T.1,2 and Gisel A.1 1International Institute of Tropical Agriculture, IITA, Ibadan, Nigeria. 2University of Ibadan, Ibadan, Nigeria. 21st IARSAF Symposium, IITA Ibadan, April 2018
  • 2.
    www.iita.org I www.cgiar.org INTRODUCTION •Cassava crop important for food security • SSA produces around 9.2 tons/ha | world average 12.3 tons/ha • A number of factors responsible for this including pests and diseases such as CBSD and CMD (Hillocks et al., 2015; Mohammed et al., 2016). • Tackling this menace entails deep understanding of host- virus interaction for enhanced breeding.
  • 3.
    www.iita.org I www.cgiar.org INTRODUCTIONCONTD. • When infected by virus, plants put up a defense! • One of such defense mechanisms involves production of small RNAs • Small RNAs act to post-transcriptionally regulate target genes Figure 1: Mechanism of gene silencing by small RNAs
  • 4.
    www.iita.org I www.cgiar.org INTRODUCTIONCONTD. • NGS technologies with high parallelization of sample sequencing have made it easier to understand genomic bases of diseases Sequencing PCR Library preparation Figure 2: Steps in NGS sequencing Source: https://www.slideshare.net/ueb52/introduction-to-next-generation-sequencing-v2
  • 5.
    www.iita.org I www.cgiar.org OBJECTIVES •In this work, we aim to study the defense mechanism of Cassava when infected with CMV using a computational technique based on NGS high throughput sequencing data 1. Identify the small RNAs that are produced upon CMV infection 2. Predict the gene targets of these small RNAs 3. Compare the expression profiles of the susceptible clones with respect to the resistant clones to CMD
  • 6.
    www.iita.org I www.cgiar.org MATERIALSAND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates TMEB117 TMS4(2)425 Figure 3: Cassava genotypes used for the study
  • 7.
    www.iita.org I www.cgiar.org MATERIALSAND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates TMEB117 TMS4(2)425 TMS961089A TMS011412 Figure 3: Cassava genotypes used for the study
  • 8.
    www.iita.org I www.cgiar.org MATERIALSAND METHODS • Four genotypes of two resistant and two susceptible Cassava plants to CMD in three replicates • RNA extracted from leaf samples for sequencing TMEB117 TMS4(2)425 TMS961089A TMS011412 Figure 3: Cassava genotypes used for the study
  • 9.
    www.iita.org I www.cgiar.org MATERIALSAND METHODS CONTD. Computational pipeline for the analysis Sequence Quality control Expression Analysis Experimental verification Regulatory network analysis Target Prediction Figure 4: Pipeline for the computational analysis P-value <= 0.05
  • 10.
    www.iita.org I www.cgiar.org RESULTS Hostand virus mapping 0 50000 100000 150000 200000 250000 300000 350000 Total reads Genome-aligned reads Virus-aligned reads Figure 5: Mapping profile of the Cassava genotypes to the host genome and virus repository
  • 11.
    www.iita.org I www.cgiar.org RESULTScontd. Table1: List of some small RNAs and the targets Exp ID source Chromosome Sequence sample1 sample2 sample3 target chromosome MFE p-value target feature target gene AB A1-13163_21_x103 Chromosome01 TACACCACCGGACCAATAGAA 103 10 158 Scaffold01258-32208-33206 -35.9 0.049197 gene Manes.S079000 AB A1-749563_21_x463 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 AB A1-2429018_20_x910 Chromosome08 AGGCGTTGGTGAAAAGGTAA 910 18 2780 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700 AD A1-507298_21_x1040 Chromosome15 TTCTCAACTTCAGGATCTGGA 4957 1464 11841 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300 AD A2-1428860_21_x21 Chromosome10 AATTCATGGGGTCCCAGAGGG 463 21 535 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 AD A3-975428_21_x13 Chromosome02 TTGGGCTTGATCCTGTTGCTC 22 30 13 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100 CB C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900 CB C2-212596_20_x66 Chromosome08 AGGCGTTGGTGAAAAGGTAA 124 66 74 Chromosome01-28692693-28693691 -36.1 0.044234 gene Manes.01G190700 CB C4-1449608_21_x13 Chromosome01 CGAACAAGTTGAGCGGAGTGG 33 23 13 Chromosome10-16304233-16305231 -37.9 0.027946 no annotation CD C1-101279_21_x5253 Chromosome15 TTCTCAACTTCAGGATCTGGA 5253 2488 2660 Chromosome05-26755030-26756028 -36 0.047833 gene Manes.05G194300 CD C1-1071842_21_x3 Chromosome02 TTGGGCTTGATCCTGTTGCTC 315 93 260 Chromosome06-25792565-25793563 -37.7 0.02958 prom-500 Manes.06G155100 CD C1-2490783_21_x58 Chromosome10 AATTCATGGGGTCCCAGAGGG 58 55 41 Chromosome15-1638064-1639062 -39.1 0.019855 term-1500 Manes.15G020900
  • 12.
    www.iita.org I www.cgiar.org RESULTScontd. • Comparing TMEB117 with both resistant lines Genotype TMS961089A TMS011412 Common 163 Peculiar 55 15 Total 218 178 1516355 TMS961089A TMS011412 Figure 6: Comparison of TMEB117 with the two resistant genotypes to CMD
  • 13.
    www.iita.org I www.cgiar.org RESULTScontd. • Comparing TMS4(2)425 with both resistant lines Genotype TMS961089A TMS011412 Common 158 Peculiar 57 19 Total 215 177 1915857 TMS961089A TMS011412 Figure 7: Comparison of TMS4(2)425 with the two resistant genotypes to CMD
  • 14.
    www.iita.org I www.cgiar.org RESULTScontd. • Comparing TMEB117 with TMS4(2)425 Genotype TMEB117 TMS4(2)425 Common 212 Peculiar 18 22 Total 230 234 2221218 TMEB117 TMS4(2)425 Figure 8: Comparison of the two susceptible genotypes to CMD
  • 15.
    www.iita.org I www.cgiar.org RESULTScontd. Preliminary findings • Small RNAs produced upon CMV infection have been identified in the genotypes of Cassava that are susceptible to CMD • The targets of the identified small RNAs have been predicted • Non-mapping of the identified small RNAs to miRBase is an interesting development – this suggests novelty
  • 16.
    www.iita.org I www.cgiar.org RESULTScontd. Preliminary findings • Small RNAs produced upon CMV infection have been identified in the genotypes of Cassava that are susceptible to CMD • The targets of the identified small RNAs have been predicted • Non-mapping of the identified small RNAs to miRBase is an interesting development – this suggests novelty Future directions • Analysis of the gene regulatory network mediated by these miRNAs • Laboratory verification of these targets using RT-PCR
  • 17.
    www.iita.org I www.cgiar.org •Thank you for listening
  • 18.

Editor's Notes

  • #3 The importance of Cassava to majority of world population cannot be overemphasized. Millions of people dependent on this as the major source of food
  • #4 Just like the human body immunity system that kicks into action at the onset of infection, the plant defense mechanism is also activated causing a chain of events. The production of miRNAs and other small RNAs is one of these events. The small RNAs bind to mRNAs transcribed from genes and prevent the genes from being translated into proteins – either through degradation of the mRNA in the case of perfect sequence complementarity or blockage of translation in the case of imperfect base-pairing.
  • #5 The parallelization obtained in NGS technologies make it easier to sequence samples and this aids the investigation of the genomic bases of diseases among other things.
  • #7 Four genotypes of cassava with clearly different traits in terms of resistance or susceptibility to CMD are used in this study.
  • #8 Four genotypes of cassava with clearly different traits in terms of resistance or susceptibility to CMD are used in this study.
  • #9 Four genotypes of cassava with clearly different traits in terms of resistance or susceptibility to CMD are used in this study.
  • #11 The figure is a result of the mapping of the sample sequences to the host genome as well as the virus repository. This clearly shows the abundance of the reads mapping to the virus repository in the susceptible genotypes as compared with the resistant genotypes.
  • #13 Owing to the varying degree of susceptibility of the genotypes, they are both compared with each of the resistant genotypes